Java代写:CSE142DNA


熟悉DNA结构,练习基本的Java I/O操作,处理DNA数据。

Requirement

This assignment focuses on arrays and file/text processing. Turn in a file
named DNA.java. You will also need the two input files dna.txt and ecoli.txt
from the course web site. Save these files in the same folder as your program.
The assignment involves processing data from genome files. Your program should
work with the two given input files. If you are curious (this is not
required), the National Center for Biotechnology Information publishes many
other bacteria genome files. The last page tells you how to use your program
to process other published genome files.

Background Information About DNA

Note: This section explains some information from the field of biology that is
related to this assignment. It is for your information only; you do not need
to fully understand it to complete the assignment.
Deoxyribonucleic acid (DNA) is a complex biochemical macromolecule that
carries genetic information for cellular life forms and some viruses. DNA is
also the mechanism through which genetic information from parents is passed on
during reproduction. DNA consists of long chains of chemical compounds called
nucleotides. Four nucleotides are present in DNA: Adenine (A), Cytosine (C),
Guanine (G), and Thymine (T). DNA has a double-helix structure (see diagram
below) containing complementary chains of these four nucleotides connected by
hydrogen bonds.
Certain regions of the DNA are called genes. Most genes encode instructions
for building proteins (they’re called “protein-coding” genes). These proteins
are responsible for carrying out most of the life processes of the organism.
Nucleotides in a gene are organized into codons. Codons are groups of three
nucleotides and are written as the first letters of their nucleotides (e.g.,
TAC or GGA). Each codon uniquely encodes a single amino acid, a building block
of proteins.
The process of building proteins from DNA has two major phases called
transcription and translation, in which a gene is replicated into an
intermediate form called mRNA, which is then processed by a structure called a
ribosome to build the chain of amino acids encoded by the codons of the gene.
The sequences of DNA that encode proteins occur between a start codon (which
we will assume to be ATG) and a stop codon (which is any of TAA, TAG, or TGA).
Not all regions of DNA are genes; large portions that do not lie between a
valid start and stop codon are called intergenic DNA and have other (possibly
unknown) functions. Computational biologists examine large DNA data files to
find patterns and important information, such as which regions are genes.
Sometimes they are interested in the percentages of mass accounted for by each
of the four nucleotide types. Often high percentages of Cytosine (C) and
Guanine (G) are indicators of important genetic data.
For more information, visit the Wikipedia page about DNA:
http://en.wikipedia.org/wiki/DNA

In this assignment you read an input file containing named sequences of
nucleotides and produce information about them. For each nucleotide sequence,
your program counts the occurrences of each of the four nucleotides (A, C, G,
and T). The program also computes the mass percentage occupied by each
nucleotide type, rounded to one digit past the decimal point. Next the program
reports the codons (trios of nucleotides) present in each sequence and
predicts whether or not the sequence is a protein-coding gene. For us, a
protein-coding gene is a string that matches all of the following
constraints*:

  • begins with a valid start codon (ATG)
  • ends with a valid stop codon (one of the following: TAA, TAG, or TGA)
  • contains at least 5 total codons (including its initial start codon and final stop codon)
  • Cytosine (C) and Guanine (G) combined account for at least 30% of its total mass
    (*These are approximations for our assignment, not exact constraints used in
    computational biology to identify proteins.)
    The DNA input data consists of line pairs. The first line has the name of the
    nucleotide sequence, and the second is the nucleotide sequence itself. Each
    character in a sequence of nucleotides will be A, C, G, T, or a dash
    character, “-“. The nucleotides in the input can be either upper or lowercase.
    Input file dna.txt (partial):
    cure for cancer protein
    ATGCCACTATGGTAG
    captain picard hair growth protein
    ATgCCAACATGgATGCCcGATAtGGATTgA
    bogus protein
    CCATt-AATgATCa-CAGTt
    The dash “-“ characters represent “junk” or “garbage” regions in the sequence.
    For most of the program they should be ignored in your computations, though
    they do contribute to the total mass of the sequence as described later.

Program Behavior

Your program begins with an introduction and prompts for input and output file
names. You may assume the user will type the name of an existing input file
that is in the proper format. Your program reads the input file to process its
nucleotide sequences and outputs the results into the given output file.
Notice the nucleotide sequence is output in uppercase, and that the nucleotide
counts and mass percentages are shown in A, C, G, T order. A given codon such
as GAT might occur more than once in the same sequence.
Log of execution (user input underlined):
This program reports information about DNA nucleotide sequences that may encode proteins.
Input file name? dna.txt
Output file name? output.txt
Output file output.txt after above execution (partial):
Region Name: cure for cancer protein
Nucleotides: ATGCCACTATGGTAG
Nuc. Counts: [4, 3, 4, 4]
Total Mass%: [27.3, 16.8, 30.6, 25.3] of 1978.8
Codons List: [ATG, CCA, CTA, TGG, TAG]
Is Protein?: YES
Region Name: captain picard hair growth protein
Nucleotides: ATGCCAACATGGATGCCCGATATGGATTGA
Nuc. Counts: [9, 6, 8, 7]
Total Mass%: [30.7, 16.8, 30.5, 22.1] of 3967.5
Codons List: [ATG, CCA, ACA, TGG, ATG, CCC, GAT, ATG, GAT, TGA]
Is Protein?: YES
Region Name: bogus protein
Nucleotides: CCATT-AATGATCA-CAGTT
Nuc. Counts: [6, 4, 2, 6]
Total Mass%: [32.3, 17.7, 12.1, 29.9] of 2508.1
Codons List: [CCA, TTA, ATG, ATC, ACA, GTT]
Is Protein?: NO

Implementation Guidelines, Hints, and Development Strategy

The main purpose of this assignment is to demonstrate your understanding of
arrays and array traversals with for loops. Therefore, you should use arrays
to store the various data for each sequence. In particular, your nucleotide
counts, mass percentages, and codons should all be stored using arrays.
Additionally you should use arrays and for loops to transform the data from
one form to another as follows:

  • from the original nucleotide sequence string to nucleotide counts;
  • from nucleotide counts to mass percentages; and
  • from the original nucleotide sequence string to codon triplets.
    These transformations are summarized by the following diagram using the “cure
    for cancer” protein data:
    Nucleotides:
    Recall that you can print any array using the method Arrays.toString. For
    example:
    int[] numbers = {10, 20, 30, 40};
    System.out.println(“my data is “ + Arrays.toString(numbers)); // my data is [10, 20, 30, 40]
    —|—

To compute mass percentages, use the following as the mass of each nucleotide
(grams/mol). The dashes representing “junk” regions are excluded from many
parts of your computations, but they do contribute mass to the total.

  • Adenine (A): 135.128
  • Cytosine (C): 111.103
  • Guanine (G): 151.128
  • Thymine (T): 125.107
  • Junk (-): 100.000
    For example, the mass of the sequence ATGG-AC is (135.128 + 125.107 + 151.128
  • 151.128 + 100.000 + 135.128 + 111.103) or 908.722. Of this, 270.256 (29.7%)
    is from the two Adenines; 111.103 (12.2%) is from the Cytosine; 302.256
    (33.3%) is from the two Guanines; 125.107 (13.8%) is from the Thymine; and
    100.000 (11.0%) is from the “junk” dash.
    We suggest that you start this program by writing the code to read the input
    file. Try writing code to simply read each protein’s name and sequence of
    nucleotides and print them. Read each line from the input file using Scanner’s
    nextLine method. This will read an entire line of input and return it as a
    String.
    Next, write code to pass over a nucleotide sequence and count the number of
    As, Cs, Gs, and Ts. You can use a String’s charAt method to get individual
    characters. Put your counts into an array of size 4. To map between
    nucleotides and array indexes, you may want to write a method that converts a
    single character (i.e. A, C, T, G) into indices (i.e. 0 to 3).
    Once you have the counts working correctly, you can convert your counts into a
    new array of percentages of mass for each nucleotide using the preceding
    nucleotide mass values. If you’ve written code to map between nucleotide
    letters and array indexes, it may also help you to look up mass values in an
    array such as the following: double[] masses = {135.128, 111.103, 151.128,
    125.107};
    You may store your mass percentages already rounded to one digit past the
    decimal or you can round when printing the mass percentages array using
    printf. If you choose to store the percentages pre-rounded, use Math.round as
    follows:
    double num = 1.6666667;
    double rounded = Math.round(num * 10.0) / 10.0;
    System.out.print(“the answer is “ + rounded); // the answer is 1.7
    —|—
    Remember that the “junk” dashes do contribute mass to the total. For other
    parts of your program you may want to remove dashes from the input; consider
    using the replace method on the nucleotide string to eliminate these
    characters.
    After computing mass percentages, you must break apart the sequence into
    codons and examine each codon. You may wish to review the methods of String
    objects as presented in Chapters 3 and 4, such as substring, charAt, indexOf,
    replace, toUpperCase, and toLowerCase.
    We also suggest that you first get your program working correctly printing its
    output to the console before you save the output to a file. Once you have your
    program printing correct output to the console, save the output to a file by
    using a PrintStream as described in Section 6.4 of the textbook.
    You may assume that the input file exists, is readable, and contains valid
    input. (In other words, you should not re-prompt for input or output file
    names.) You may assume that each sequence’s number of nucleotides (without
    dashes) will be a multiple of 3, although the nucleotides on a line might be
    in either uppercase or lowercase or a combination. Your program should
    overwrite any existing data in the output file (this is the default
    PrintStream behavior).

Style Guidelines

For this assignment you are required to have the following four class
constants:

  • one for the minimum number of codons a valid protein must have, as an integer (default of 5)
  • a second for the percentage of mass from C and G in order for a protein to be valid, as an integer (default of 30)
  • a third for the number of unique nucleotides (4, representing A, C, G, and T)
  • a fourth for the number of nucleotides per codon (3)
    For full credit it should be possible to change the first two constant values
    (minimum codons and minimum mass percentage) and cause your program to change
    its behavior for evaluating protein validity. The other two constants won’t
    ever be changed but are still useful to make your program more readable. Refer
    to these constants in your code and do not refer to the bare number such as 4
    or 3 directly. You may use additional constants if they make your code
    clearer.
    We will grade your method structure strictly on this assignment. Use at least
    four nontrivial methods besides main. These methods should use parameters and
    returns, including arrays, as appropriate. The methods should be
    wellstructured and avoid redundancy. No one method should do too large a share
    of the overall task. The textbook’s case study at the end of Chapter 7 is a
    good example of a larger program with methods that pass arrays as parameters.
    In particular, we require that you have the following particular method in
    your program:
  • A method to print all file output for a given potential protein (nucleotides, counts, %, is it a protein, etc.)
    In other words, all output to the file should be done through one method
    called on each nucleotide sequence from the input. Your other methods should
    do the computations to gather information to be passed to this output method.
    Your main method should be a concise summary of the overall program. It is
    okay for main to contain some code such as println statements. But main should
    not perform too large a share of the overall work itself, such as examining
    each character of an input line. Also avoid “chaining,” when many methods call
    each other without ever returning to main.
    We will also check strictly for redundancy on this assignment. If you have a
    very similar piece of code that is repeated several times in your program,
    eliminate the redundancy such as by creating a method, by using for loops over
    the elements of arrays, and/or by factoring if/else code as described in
    section 4.3 of the textbook.
    Since arrays are a key component of this assignment, part of your grade comes
    from using arrays properly. For example, you should reduce redundancy as
    appropriate by using traversals over arrays (for loops over the array’s
    elements). This is preferable to writing out a separate statement for each
    array element (a statement for element [0], then another for [1], then for
    [2], etc.). Also carefully consider how arrays should be passed as parameters
    and/or returned from methods as you are decomposing your program. Recall that
    arrays use reference semantics when passed as parameters, meaning that an
    array passed to a method can be modified by that method and the changes will
    be seen by the caller.
    You are limited to features in Chapters 1 through 7. Follow past style
    guidelines such as indentation, names, variables, types, line lengths, and
    comments (at the beginning of your program, on each method, and on complex
    sections of code).

Additional Input Files (Optional)

If you would like to generate additional input files to test your program, you
can create them from actual NCBI genetic data. The following web site has many
data files that contain complete genomes for viruses:
ftp://ftp.ncbi.nlm.nih.gov/genomes/Viruses/
The site contains many directories with names of organisms. After entering a
directory, you can find and save a genome file (a file whose name ends with
.fna) and a protein table (a file whose name ends with .ptt). On the course
web site we will provide you with a program to convert these .fna and .ptt
files into input files suitable for your homework.


文章作者: SafePoker
版权声明: 本博客所有文章除特別声明外,均采用 CC BY 4.0 许可协议。转载请注明来源 SafePoker !
赏
  目录